Publications

3795

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Mandarin (Citrus reticulata) is the most important cash crop in Bhutan and plantations total approximately 1.8 million trees (Ministry of Agriculture, Thimphu, Bhutan, 2000). Most trees are a local mandarin variety. Seedlings trees are produced by local farmers or supplied by Druk Seed Nursery. Mandarin seedlings have also been introduced from India. In the mid-1990s, mandarin trees growing in Punakha Valley and Wangdue districts began showing symptoms of decline that included sparse yellow foliage and shoot die-back. After initial surveys in 2000, huanglongbing (HLB) was suspected as the cause of declining trees based on symptomatology and presence of the psyllid vector Diaphorina citri, but no confirmatory tests were carried out. In August 2002, we surveyed eight locations in the valley from Rimchu (North) to Kamichu (South). HLB-like leaf mottle symptoms were observed on declining mandarin trees at all locations at altitudes ranging from 700 to 1,450 m. Orchards around Punakha (1,350m) in the center of the valley were more severely affected. Symptoms were also observed on Mexican lime (Citrus aurantifolia), citron (Citrus medica), and on tangelo trees (Minneola, Seminola, and Iyo) introduced originally as certified HLB-free budwoods from Corsica, France and grafted onto Rangpur lime at the Wangdue Research Center (1,300m). Leaves were collected from symptomatic trees and three declining mandarin trees without characteristic leaf mottle symptoms. Two specific polymerase chain reaction (PCR) tests for the detection of HLB Liberibacter species (1,2) were carried out on 16 DNA samples extracted from leaf mid-veins of 10 mandarins, two Mexican limes, three tangelos, and one citron tree. “Candidatus Liberibacter asiaticus” was readily detected by both PCR assays in all but two samples (one mandarin with noncharacteristic symptoms and citron) and all sampled orchards. The presence in the Wangdue Research Center of liberibacter infected trees, propagated from certified HLB-free budwoods, suggests that natural spread of the HLB by D. citri is occuring, as the psyllid had been identified previously in the Punakha area by Bhutanese Entomologists. It is likely that the disease was originally introduced as infected planting material although its source has not been determined. References: (1) A. Hocquellet et al. Mol. Cell. Probes 13:373, 1999. (2) S. Jagoueix et al. Mol. Cell.Probes 10:43,1996.