SeqCode Logo SeqCode Registry
cognitis nomina
  • About
  • Search
  • •
  • Login
  • Register
Authors Baranwal

JSON
See as cards

Baranwal, V. K.


Publications
6

CitationNamesAbstract
Association of ‘Candidatus Phytoplasma asteris’ with phyllody of Crown Daisy in India Singh et al. (2024). Australasian Plant Pathology 53 (6) Ca. Phytoplasma asteris
Evidence of association of a ‘Candidatus Phytoplasma cynodontis’ with bermuda grass (Cynodon dactylon) and ‘Candidatus Phytoplasma asteris’ with periwinkle (Catharanthus roseus) from western Uttar Pradesh, India Khanna et al. (2015). Crop Protection 74 Ca. Phytoplasma asteris Ca. Phytoplasma cynodontis
Molecular characterization of ‘Candidatus Phytoplasma asteris’ subgroup I-B associated with sesame phyllody disease and identification of its natural vector and weed reservoir in India un Nabi et al. (2015). Australasian Plant Pathology 44 (3) Ca. Phytoplasma asteris
New host record of a ‘Candidatus Phytoplasma asteris’-related strain infecting peach in India Singh et al. (2014). Australasian Plant Disease Notes 9 (1) Ca. Phytoplasma asteris
Polymerase chain reaction detection of greening bacterium (Candidatus Liberibacter asiaticus) and Citrus mosaic virus in citrus tissues, by means of a simplified template-preparation protocol Baranwal et al. (2007). Canadian Journal of Plant Pathology 29 (2) “Liberibacter asiaticus”
First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan Ahlawat et al. (2003). Plant Disease 87 (4) “Liberibacter asiaticus”
Text

First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan
During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.
Search