Plant Disease

Mulberries (Morus spp.) are important crops valued for berry and silk production (Baciu et al., 2023). In March 2025, a mulberry tree in Dongshi, Taichung, Taiwan, was found bearing fruits showing phyllody symptoms. To determine whether the disease was associated with phytoplasma infection, symptomatic fruits were collected from five branches and tested. For the controls, asymptomatic berries were sampled from three symptomless mulberry trees in Wufeng, Taichung in April 2025. DNA was extracted from five symptomatic fruits collected from different branches and three symptomless berries obtained from separate asymptomatic trees. DNA was extracted with a Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics). To ensure that DNA qualities were sufficient for PCR assays, the samples were tested with primers 28KJ and 28C targeting the plant’s 26S rDNA (Cullings 1992). PCR was conducted with the GoTaq Green Master Mix (Promega), and every sample produced the expected amplicon (~685 bp). Nested PCR tests were conducted using universal phytoplasma primer pairs P1/ P7 (outer; Schneider et al. 1995) and R16F2n/R16R2 (inner; Gundersen and Lee 1996). Four out of five symptomatic samples amplified the 1.25-kb target fragment in the nested assay, while none of the asymptomatic samples did. The 16S rDNA of a representative symptomatic sample was sequenced (GenBank/DDBJ accession no. LC897699) and subjected to analysis using iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi). The detected phytoplasma was classified to the 16SrI-B subgroup with a similarity coefficient of 1.0 (compared to a reference pattern; ‘Candidatus Phytoplasma asteris’ OY; accession no. AP006628) and was found to share 99.68% 16S rDNA sequence similarity with a ‘Ca. Phytoplasma asteris’ reference strain (accession no. M30790). To validate this finding, the sample was also tested with other phytoplasma gene-specific nested primers targeting the elongation factor Tu (tuf) and ribosomal protein (rp) genes. For tuf, primer pairs fTuf1/rTuf1 and fTufAy/rTufAy were respectively used for the first and second round of PCR (Schneider and Gibb 1997). For rp, the outer and inner primer pairs were rpF1/rpR1 and rp(I)F1A/rp(I)R1A, respectively (Martini et al. 2007). Both target gene fragments were successfully amplified, and the inner amplicons were sequenced. BLASTn (core_nt) searches using quality-trimmed sequences showed that the obtained tuf sequence (accession no. LC896430) was most similar to that of ‘Ca. Phytoplasma asteris’ OY (accession no. AP006628; 99.9%; 830/831 bp) and those of various 16SrI strains. The detected rp sequence (accession no. LC896429) shared the highest identity with that of a ‘Ca. Phytoplasma asteris’ strain infecting Boehmeria pannosa (16SrI‑B; accession no. MT739521; 99.9%; 1,056/1,057 bp) and those of other 16SrI strains, and was very similar to that of ‘Ca. Phytoplasma asteris’ OY (accession no. AP006628; 99.6%; 1,053/1,057 bp). Accordingly, the phytoplasma detected in this study was identified as a ‘Ca. Phytoplasma asteris’-related strain belonging to subgroup 16SrI-B. In Taiwan, 16SrI phytoplasmas have been reported affecting plants such as Murraya exotica (Tseng et al. 2022). This is the first report of a 16SrI phytoplasma related with Morus symptoms in Taiwan. Since the disease directly impacts the commercial value of the berries, the pathogen should be carefully monitored in mulberry-producing areas.

Symptoms of growth abnormalities including shoot proliferation, leaf rosetting and witches’ broom symptoms, reduction in leaf size, downward rolling of leaf margins, distortion and chlorotic foliage were observed in several tree species in a Hungarian park forest in Martonvásár in the summer of 2022. In subsequent years, we observed the progression of the disease. This was manifested by the death of shoots and twigs, as well as an overall reduction in growth. The affected woody species were: Fraxinus excelsior, Acer campestre, Acer platanoides, Ulmus minor and Sambucus nigra. The observed symptoms were reminiscent of those observed in phytoplasma infections of other woody plants. The present study aimed to investigate whether the disease in these species was also caused by a phytoplasma. Shoot samples were taken from ten symptomatic, and three asymptomatic plants of each species. Total nucleic acids were extracted from the phloem tissue using the CTAB method (Ahrens and Seemüller 1992). To specifically amplify phytoplasma DNA, the universal primer pairs fP1/rP7 (Smart et al., 1996), followed by R16F2n/R16R2 (Gundersen and Lee, 1996)or fU5/rU3 (Lorenz et al., 1995) were used in a nested PCR. Amplicons of the expected sizes were obtained from 90% of the symptomatic samples (fP1/rP7 1783 bp, R16F2n/R16R2: 1.2 kb, fU5/rU3: 876 bp), but none from the asymptomatic ones. The R16F2n/R16R2-amplified products obtained from the five species were cloned (at least three from each PCR reaction), sequenced and deposited in GenBank under the following accession numbers PX491300 (F. exelsior), PX491301 (S. nigra), PX491302 (A. campestre), PX491303 (U. minor) and PX491304 (A. platanoides). The sequences of the five isolates were almost identical, showing a 99.92%-100% identity with each other. A BLAST search of GenBank yielded 99.92% sequence similarity in the case of the S. nigra isolate and 100% in the case of the other 4 isolates with the onion yellows phytoplasma strain OY-M (GenBank AP006628) from the ‘Candidatus Phytoplasma asteris’ 16SrI-B subgroup. To confirm the pathogen’s identity in subsequent experiments, the elongation factor Tu (tuf) and the translocase protein (secY) genes were amplified using the universal primer pairs fTuf1/rTuf1 (Schneider and Gibb, 1997), and the aster yellows-specific AYsecY_F-46/AYsecY_R1450 primer pairs (Viczián et al. 2023), respectively. Amplicons of the expected sizes (1085 bp for fTuf1/rTuf1, and 1520 bp for AYsecY_F-46/AYsecY_R1450) were produced from 84% of the symptomatic plants across all five species, but not from the asymptomatic ones. The PCR fragments were cloned and sequenced, and sequences obtained for the tuf and secY genes were deposited in GenBank under the accession numbers PV648950-PV648954, and PV854856-PV854860, respectively. The sequences obtained from the five plant species were almost identical, sharing 99.81% identity with the Aster yellows phytoplasma strains IRap (AJ271316.1) and ORN (MN526022.1) in the case of the elongation factor TU, and 100% identity with the strains De Villa (CP035949.1) and M8 (CP128414.1) in the case of the SecY translocase protein. In iPhyClassifier analysis, the virtual RFLP patterns derived from the query 16S rDNA F2nR2 fragments were identical (similarity coeffcient 1.00) to the reference pattern of 16Sr group I, subgroup B (GenBank accession: AP006628). These results clearly indicate that the five tree species under study were affected by the aster yellows phytoplasma, which is assigned to the 16SrI-B subgroup of the 16SrI group and is caused by the bacterial agent 'Candidatus Phytoplasma asteris'. Although this phytoplasma is known to infect a wide range of hosts (Lee et al., 2004), aster yellows has only been reported on F. exelsior in Poland (Kamińska and Berniak, 2009) of the five plant species studied here. To our knowledge, this is the first report of aster yellows on A. campestre, A. platanoides, U. minor and S. nigra worldwide, and on F. exelsior in Hungary.

Insecticide applications are commonly recommended for managing Diaphorina citri, the vector of huanglongbing (HLB), but their effectiveness in reducing transmission of ‘Candidatus Liberibacter asiaticus’ (CLas), especially during continuous psyllid influx and shoot growth, remains unclear. This study evaluated the efficacy of foliar application of thiamethoxam and spinetoram in reducing CLas transmission in sweet orange seedlings. Two experiments were conducted up to 13th days after first spray. In experiment #1, CLas-positive psyllids were confined in seedlings every two days. Treatments were: control; S14 — one spray at day 0; and S7 — sprays at days 0 and 7. In experiment #2, psyllids were released for free choice within a screenhouse every two days. Treatments were: control; S14; S7; and S3 — sprays at day 0 and every 3 days. Sprays on day 0 were over unfolded leaves (V2 stage). Psyllid mortality was assessed in experiment #1. Psyllid occupancy (percentage of seedlings with at least one psyllid) and abundance (number of psyllids per seedling) were assessed in experiment #2. After 6 months, seedlings were tested for CLas by qPCR. In experiment #1, cumulative psyllid mortality was higher in sprayed treatments than control for both insecticides, but HLB incidence was similar. In experiment #2, both psyllid occupancy and abundance decreased with shorter spray intervals, with the lowest HLB incidence in S3. These findings suggest that reducing spray intervals can limit CLas transmission during periods of shoot growth and continuous vector pressure. However, CLas transmission was not entirely prevented, highlighting the need for integrated, area-wide management strategies.

Big Basin Sagebrush (Artemisia tridentata ssp. tridentata) is a common shrub found across high desert and arid regions of North America. Although its natural distribution has been reduced over the past century due to farm and urban expansion it remains a keystone species in much of the high desert and is a host for native arthropod species. However, there have been few studies that examined the effect of phytopathogens on A. tridentata (Allen & West 1987; Welch & Nelson 1995). During a survey for alternate hosts of the X-disease phytoplasma (‘Candidatus Phytoplasma pruni’) (Shires et al. 2025) we observed phytoplasma-like foliar chlorosis and dieback-like symptoms on A. tridentata in uncultivated areas of Chelan County, WA. Approximately 30-40% of plants were symptomatic at these sites, and symptom progression was seasonal, with the emergence of enlarged, pale-yellow chlorotic leaves between late spring (May-June) and summer (July-August). Chlorosis began at the leaf apex and extended towards the petiole, with tip necrosis then leaf drop occurring in late August (Figure 1). Dieback of shoot apices and limbs was also observed on individual plants. Leaf and stem tissues were collected from 19 symptomatic and 63 asymptomatic sagebrush at three sites in Chelan Co., DNA extracted using the Qiagen DNeasy plant mini kit (Qiagen Corp. Germantown, MD) per the manufacturer’s instructions, and tested for 16SrIII phytoplasmas on the basis of proximity to orchards known to be infected with ‘Ca. P. pruni’ by qPCR as per Shires et al. (2025). All symptomatic plants tested positive, while asymptomatic plants did not. For identification, the partial 16S rRNA gene was amplified from seven samples by nested PCR using the P1/P7 (Deng & Hiruki 1991) then R16F2n/R2 primers (Gundersen & Lee 1996); resulting products were Sanger-sequenced (Eton Biosciences, San Diego, CA) and deposited in GenBank (PV994682-PV994688). Examination using iPhyClassifier (Zhao et al. 2012) indicated that these were a ‘Ca. P. pruni’-related strain with 99.66% identity to reference sequence JQ0443393. BLASTn indicated a 100% nucleotide identity match to Lilac decline phytoplasma strain LlcDec1 (KP877578) (Davis et al. 1996). For further identification, the partial secY (849 bp), secA (490 bp), Ef-Tu (793 bp), and imp (457 bp) genes were amplified and sequenced as per Molnar et al. (2024). Of these secY (PX023655-PX023661), secA (PX023662-PX023668) and Ef-Tu (PX023669-PX023675) had 99.8%, 98.9% and 98.5% identity to X-disease strains PX11CT1 (JQ268254), 20-15 (OR67122), and 22-2470 (OR670177) respectively, whereas imp (PX023676-PX023682) had 96.9 % identity to PoIBI strain “Annette Hegg Maxi” (AB636364) (100% coverage for all fragments). Neighbor-joining phylogenetic analysis of the concatenated marker regions showed that this phytoplasma forms a separate clade from other 16SrIII strains, and whose closest relative is PoiBI strain JR1 (ASM30946v1) with 98.9% identity across the aligned region (Figure 2). Cumulatively these data suggest the Sagebrush yellows-associated phytoplasma is a ‘Ca. P. pruni’-related strain that is novel and distinct from previously described members of the 16SrIII group, based on sequence identity and the host on which it causes disease. This find is significant as it is the first report of a novel phytoplasma infecting a keystone species in western North America and an indicator of where 16SrIII phytoplasmas infecting cultivated plants may have originated.

Cultivation of prickly pear (Opuntia ficus-indica L., family Cactaceae) is of high value in dry-land agriculture in Jordan. In May 2021, symptoms including thickening and severe stunting of the cladodes and deformation of fruits were observed on prickly pear plants cultivated in southern Jordan, Madaba region (31.593565 N, 35.850111 E), with a 15% incidence across three cactus fields. To verify the occurrence of a graft-transmissible disease, wedge grafting was performed on asymptomatic opuntia rootstocks, resulting in thickened cladodes and deformed fruits within five weeks. Samples of cladodes from naturally infected plants were collected from fourteen symptomatic and one asymptomatic plant. A nested polymerase chain reaction (PCR) performed by using primer pair P1/P7 (Deng and Hiruki 1991; Schneider et al. 1995), followed by R16F2n/R16R2 (Gundersen and Lee 1996), amplified a fragment of the expected size only from the symptomatic samples. Direct amplicon sequencing followed by blast comparison to both, GenBank and EPPO-QBank databases (https://qbank.eppo.int/phytoplasmas/) allowed the identification of a ’Candidatus Phytoplasma australasiae=australasiaticum’ strain (GenBank accession no. PQ319761, designated strain ´Cact1´), with a 100% sequence identity to the reference strain (GenBank accession no. Y10097, ribosomal subgroup 16SrII-D) (White et al., 1998; Rodrigues et al., 2023). The phylogenetic analysis of strain ´Cact1´ with phytoplasma strains of ribosomal subgroups in group 16SrII and detected in cactus in China, Italy and Turkey showed that strain ´Cact1´ is not clustering with any of them (Figure 1). Indeed, comparison with all sequences in GenBank, show that the phytoplasma from Jordan clusters with those enclosed in the 16SrII group under the species ‘Ca. P. australasiae=australasiaticum’, showing about 99.00% identity to this phytoplasma and having an identity to ‘Ca. P. aurantifolia=citri’ of about 98.50%, that is below the accepted threshold for ‘Ca. Phytoplasma’ strains differentiation (Bertaccini et al. 2022). This identification was confirmed by amplifying and sequencing the leucyl transfer RNA synthetase (leuS) gene (Abeysinghe et al. 2016) (GenBank accession no. PQ349195), that showed 100% sequence identity with 100% coverage to the Parthenium hysterophorus phyllody phytoplasma strain ´PR08´ from India (GenBank accession no. CP097207), identified as a strain of ‘Ca. P. australasiae=australasiaticum’ (White et al., 1998; Rodrigues et al., 2023). Other phytoplasma strains having 100% identity on the leuS gene but with 95-96% coverage were reported in pearl millet, soybean and alfalfa from India (GenBank accession no. MW020555, MW020562 and MW020559 respectively). The leuS gene sequence has been relevant to confirm the identification of phytoplasmas infecting various agricultural important crops especially in Asian countries (Tiwari et al., 2023). It is thus necessary to investigate insect vector(s) presence and search for other economically important hosts and for alternative host weeds for this phytoplasma considering that the disease and the associated phytoplasmas are present and spreading in other regions of Jordan.

‘Candidatus Liberibacter asiaticus’ (CLas), the agent associated with the Huanglongbing citrus disease, is commonly detected using quantitative PCR (qPCR) with hydrolysis probes. Internal standards are typically included in the qPCR assays to reduce the risk of false negatives caused by inhibitors. When the internal standard is detected but CLas is not, it is generally assumed that the pathogen is absent from the tested sample. However, our study shows that trace amounts of CLas may go undetected if the internal standard is either overly abundant or too dissimilar to CLas. To overcome these limitations, we developed a synthetic internal standard (IS) that uses the same primer as the CLas target sequence, along with three to four downstream nucleotides, but with a unique internal sequence derived from smooth hammerhead shark (Sphyrna zygaena; IS-SHK). This sequence matches the guanine-cytosine content and melting temperature of the CLas target and was specifically selected to minimize potential interference from other nucleic acid materials in citrus samples. To minimize competition between the IS-SHK standard and the CLas target, an average of only 21 molecules of IS-SHK standard is added to each qPCR reaction. Therefore, when IS-SHK standard is detected at expected levels and CLas is not, the absence of CLas is confirmed rather than inhibition of the detection. Conversely, the absence of both IS-SHK standard and CLas suggests the presence of a qPCR inhibitor, warranting retesting of the sample.

Okra (Abelmoschus esculentus) was cultivated on 1,342 hectares in the United States in 2023, producing 10,540 tonnes (FAOSTAT). During a field survey conducted in 2023, a single okra plant in a plot (roughly 0.1 acre) cultivated in Tulsa County, Oklahoma, displayed symptoms of virescence, phyllody, and witches’-broom. Leaf tissues were collected from one symptomatic (sample K7) and three asymptomatic plants. Total RNA and genomic DNA were extracted using the Plant RNA Isolation Kit (Norgen Biotek Corp, Ontario, Canada) and Plant DNA Kit (Omega BIO-TEK). RNA from the samples was subjected to high-throughput sequencing (HTS) on the NovaSeq X Plus at the Oklahoma Medical Research Foundation. After trimming, 16,454,026 reads (average length = 151 bp) were de novo assembled using CLC Genomics Workbench v22.0.1 (QIAGEN) and analysed via BLASTn and BLASTx analyses against the NCBI GenBank (nr) database. Thirty-six contigs (205-664 bp) showed similarity to the ‘Candidatus Phytoplasma 16SrI group with an average coverage ranging from 1.6 to 118.1X. Later in the season, disease progression was observed on the same plant (K7), and additional symptomatic leaf tissues were collected and processed as described above. The second HTS run yielded 53,701,463 reads (average length = 130 bp). De novo assembly produced 617 contigs (190-15,179 bp), matching ‘Candidatus Phytoplasma asteris’ (rapeseed phyllody phytoplasma, CP055264) with coverage ranging from 2.04 to 23,516.25X. Raw sequencing reads were deposited in the NCBI database under the Sequence Read Archive (SRA) SRR32988524. To confirm the HTS results, PCR was performed using DNA from the K7 sample and healthy okra plants, with two primer sets designed from HTS-derived contigs (1F CTCATCCTGTAAGCGTTGCC, 1R AGCGGCTTTGATGTTGGATC (446 bp), and 2F CCAAACCGCAGTGCTAACAT, 2R GTTTTGACCCCACGAGCTTT (product size 524-bp). Both expected amplicons (446 and 524 bp, respectively) were detected in the symptomatic sample (K7) but none in the asymptomatic sample. Sanger sequencing and BLASTn of the PCR products confirmed 99.03% and 99.8% nucleotide identity to the rapeseed phyllody phytoplasma isolate RP166 (GenBank accession CP055264). Additionally, the full-length 16S rRNA gene (1,521 bp) retrieved from HTS data revealed 99.8% identity with the same isolate. Based on the iPhyClassifier analysis (Wei et al. 2007; Zhao et al. 2009), the phytoplasma strain was classified as ‘Candidatus Phytoplasma asteris’ subgroup 16Srl-B. ‘Candidatus Phytoplasma asteris’ has been previously associated with phyllody in oilseed rape in Poland (Zwolińska et al. 2011), rapeseed phyllody disease (Cho et al. 2020), little leaf disease of cotton and luffa in India (Kumar et al. 2010), tomato stunt in Cuba (Zamora et al. 2014) and other crop diseases. This study presents the first confirmed report of rapeseed phyllody phytoplasma infecting okra in Oklahoma, and United States. Okra is a significant cash crop for both small and large-scale farmers and widely cultivated vegetable in Oklahoma and various other states across the United States. It has numerous nutritional benefits (vitamins, minerals, dietary fibre and antioxidants) in the human diet and traditional medicine. Okra is susceptible to various diseases. Therefore, conducting a comprehensive survey of okra fields is crucial to identify potential disease threats and to implement effective measures for the protection and sustainability of this important crop.

Citrus Huanglongbing (HLB), caused by “Candidatus Liberibacter asiaticus” (CLas), is a destructive disease threatening global citrus industry. Although citrus cultivars differ in HLB sensitivity, how infection alters endophytic bacterial communities in cultivars with contrasting susceptibility remains unclear. Here, we compared endophytic microbiome shifts in leaf and root tissue of HLB-susceptible Shatangju mandarin (C. reticulata cv. Shatangju) and HLB-tolerant Shatian pomelo (C. maxima cv. Shatian) at 10 months post grafting (MPG) with CLas-infected buds. Infected Shatangju mandarin showed severe symptoms and higher CLas levels in leaf than root, while infected Shatian pomelo remained asymptomatic with higher CLas in root than leaf. High-throughput 16S rRNA gene sequencing revealed that CLas infection restructured endophytic microbial community in tissue-specific manner. CLas-infected Shatian pomelo leaf displayed increased microbial diversity and network complexity, while CLas-infected Shatangju mandarin root harbored more disease-suppressive taxa like Streptomyces. Across both cultivars, network complexity correlated inversely with CLas abundance. Key genera (e.g., Pseudomonas, Streptomyces, Prevotella) correlated positively with CLas, suggesting roles in mitigating pathogen effects. Predicted functional profiling indicated activated pathways (amino acid metabolism, terpenoid/polyketide biosynthesis, xenobiotic biodegradation) potentially supporting host defense in infected tissues. The HLB tolerance of Shatian pomelo appeared linked to tissue-specific bacterial restructuring, particularly recruitment of antibiotic-producing bacteria and enhanced metabolic resilience. These findings elucidated cultivar-specific microbial strategies against CLas, offering insights for microbiome-mediated HLB management.