Plant Disease

Witches'-broom disease of lime (WBDL) caused by ‘Candidatus Phytoplasma aurantifolia’ is a devastating disease in the Sultanate of Oman, United Arab Emirates, and southern Iran. The disease primarily affects lime (Citrus aurantifolia), but in Iran, it is also found in bakraee, a natural C. reticulata hybrid. The disease has been experimentally transmitted from lime to several citrus cultivars by grafting and to a number of herbaceous hosts by dodder. However, the natural vector of ‘Ca. P. aurantifolia’ has not been determined. The most common phloem-feeding insect associated with lime trees in the area is the leafhopper Hishimonus phycitis. The WBDL phytoplasma has been detected in the body of this leafhopper by ELISA and PCR (1), but previous attempts to establish its vector status have failed. It was recently reported that the leafhopper can release the phytoplasma into a sugar solution by feeding through a Parafilm membrane (4). Here we report successful transmission of WBDL phytoplasma to bakraee seedlings by H. phycitis. The leafhopper nymphs and adults were collected in a WBDL-infected lime orchard in Minab (Hormozgan Province) in May of 2006. Of more than 100 leafhopper samples tested, at least 70% were positive for the phytoplasma by PCR using P1/P7 primer pair (3). Additional field-collected leafhoppers were caged (five per plant) on bakraee seedlings at the two-leaf stage in pots in the greenhouse in Zarghan (Fars Province). After 8 weeks, the remaining leafhoppers were killed with an insecticide. Six months after inoculation, 3 of 10 inoculated plants showed typical symptoms of WBDL, including bud proliferation, general chlorosis, and stunting. Symptomatic plants were strongly positive in PCR assays using primer pair P1/P7. No amplification was obtained with healthy control lime or nonsymptomatic bakraee seedlings. Amplified P1/P7 primed PCR products (1,800 bp) from experimentally vector-challenged bakraee seedlings, captured H. phycitis, and a naturally infected lime tree from Minab were subjected to restriction fragment length polymorphism (RFLP) analysis using AluI, HhaI, HpaII, RsaI, and TaqI enzymes. RFLP patterns from these sources were identical and similar to those reported earlier (2). These analyses verified the identity of WBDL phytoplasma in experimentally infected bakraee seedlings. To our knowledge, this is the first report of natural transmission of ‘Ca. P. aurantifolia’ by H. phycitis. References: (1) J. M. Bové et al. Proc. Conf. IOCV 12:342. 1993. (2) A. J. Khan et al. Phytopathology 92:1038, 2002. (3) B. Schneider et al. Pages 369–380 in: Molecular and Diagnostic Procedures in Mycoplasmology. Vol. 2. S. Razin and J. G. Tully, eds. Academic Press, New York, 1995. (4) M. Siampour et al. Iran. J. Plant Pathol. 41:139 (Farsi) and 35 (English), 2006.

Citrus huanglongbing (HLB), also known as citrus greening or citrus yellow shoot, is considered the most serious disease of citrus worldwide. The disease has Asian, African, and American forms caused by “Candidatus Liberibacter asiaticus”, “Ca. L. africanus”, and “Ca. L. americanus”, respectively, which can be spread efficiently by the psyllid vectors Diaphorina citri and Trioza erytreae and through contaminated plant materials. Infected citrus groves are usually destroyed or become unproductive in 5 to 8 years. The presumed low concentration and uneven distribution of the pathogens in citrus plants and vector insects make the phloem-limited bacterium difficult to detect consistently. In this study, we compared and validated four conventional polymerase chain reaction (PCR)-based protocols, one loop-mediated isothermal amplification (LAMP) protocol, and three TaqMan real-time PCR protocols. The detection sensitivity of the validated conventional PCR assays reported are improved compared with the original protocols. All of the validated conventional and the newly developed real-time methods were reliable for confirmatory tests for the presence of “Ca. Liberibacter spp.” in symptomatic samples. There were no differences in assay specificity among the standard format PCR-based methods evaluated. The TaqMan real-time PCR was 10- to 100-fold more sensitive than conventional PCR and LAMP, showing the potential to become a valuable tool for early detection and identification of “Ca. Liberibacter spp.” prior to the appearance of disease symptoms. The methods validated in this study will be very useful for regulatory response, effective management of infected trees, and development of a “Ca. Liberibacter spp.”-free nursery system.

Australian lucerne yellows (ALuY), a phytoplasma-associated disease, is a major problem in Australia that causes the pasture seed industry millions of dollars in losses annually (3). Samples were collected from lucerne (Medicago sativa L.) plants exhibiting symptoms indicative of ALuY (4) in a seed lucerne paddock (cv CW 5558) at Griffith, southwestern New South Wales (NSW), Australia, in November 2005 and again in January 2006. Samples were kept at 4°C and processed within 36 h of collection. Total DNA was extracted from approximately 0.3 g of leaf midribs and petioles of each plant sample and used as template in a nested PCR assay with phytoplasma universal primer pairs P1/P7 and fU5/m23sr. PCR products resulting from the first amplification were diluted (1:30) with sterile distilled water (SDW) before reamplification with fU5/m23sr. DNA of Australian tomato big bud (TBB) phytoplasma and SDW were used as positive and negative assay controls, respectively. Ten of fifteen plant samples collected in November tested positive for phytoplasma DNA. Restriction digestion profiles of nested PCR amplicons with HpaII endonuclease were the same for all symptomatic plants but differed from the control. Phytoplasma identity was determined by sequencing two nested PCR products that yielded identical sequences. One was deposited in the GenBank database (Accession No. DQ786394). BLAST analysis of the latter sequence revealed a >99.6% similarity with “Candidatus Phytoplasma australiense” (L76865) and related strains papaya dieback (Y10095), phormium yellow leaf (U43570), strawberry green petal (AJ243044), and strawberry lethal yellows (AJ243045). Direct PCR with primers FP 5′-GCATGTCGCGGTGAATAC-3′ and RY 5′-TGAGCTATAGGCCCTTAATC-3′ designed to specifically amplify DNA of “Ca. P. australiense” detected the phytoplasma in 8 of 40 samples collected in January. Whether this phytoplasma is the etiological agent solely responsible for ALuY is currently under investigation. “Ca. P. asteris” and stolbur group (16SrXII) phytoplasmas have been reported in lucerne in the United States (2) and Italy (1), respectively. Within the stolbur group 16SrXII, “Ca. P. australiense” and stolbur phytoplasma are regarded as separate species and both are distinct from “Ca. P. asteris”, a group 16SrI strain. To our knowledge, this is the first report of a “Ca. P. australiense” related strain in lucerne. References: (1) C. Marzachi et al. J. Plant Pathol. 82:201, 2000. (2) R. D. Peters et al. Plant Dis. 83:488, 1999. (3) L. J. Pilkington et al. Australas. Plant Pathol. 28:253, 1999. (4) L. J. Pilkington et al. First report of a phytoplasma associated with ‘Australian lucerne yellows’ disease. New Disease Report. Online publication at http://www.bspp.org.uk/ndr/jan2002/2001-46.asp .

Huanglongbing (greening) disease caused by a nonculturable, phloem-limited bacterium is a severe disease of citrus. On the basis of the influence of temperature on host symptoms and the causal agent, this disease can be categorized as Asian caused by “Candidatus Liberibacter asiaticus”, African caused by “Ca. L. africanus”, and American caused by “Ca. L. americanus”. Kumquat (Fortunella margarita (Lour.) Swingle), a member of the Rutaceae is an economically important crop for export and local consumption in Taiwan. Recently, a Huanglongbing-like disease was found on kumquat in Yilan County, the largest kumquat-producing area in northeastern Taiwan. Even though the disease has been reported on Citrus spp. from Taiwan, it has never been reported on kumquat. Symptoms of infected kumquat were mottling, yellowing, hardening, and curling of leaves followed by premature defoliation, twig dieback, decay of feeder rootlets and lateral roots, and ultimately the death of the entire plant. Typical sieve-tube-restricted bacteria were observed in kumquat cells by electron microscopy (1). In addition, psyllid-transmission tests demonstrated that the Asian psyllid (Diaphorina citri) could transmit this bacterium to healthy kumquats. Positive bud graft transmissions were obtained to F. margarita, F. japonica (Thunb.) Swingle, F. obovata Hort. ex Tanaka, Luchen sweet orange (Citrus sinensis (L.) Osb.), and Wentan pummelo (C. maxima f. sp. butan Hay.). These inoculated plants showed symptoms in 3 to 8 months, and bacteria could be detected by polymerase chain reaction (PCR) using a common primer pair that amplified a 226-bp specific DNA fragment (2). For further molecular identification, the bacterial DNA was extracted from the inoculated plants and PCR was performed by using two sets of primers selected from the 16S rRNA region (GenBank Accession No. L22532) and 16S/23S intergenic spacer region (GenBank Accession No. AB019793). The expected DNA fragments of 1,389 bp and 862 bp were, respectively, amplified from symptomatic plants but not from healthy plants. The PCR products were cloned and sequenced (GenBank Accession Nos. DQ302750 and DQ207841). The 16S rRNA has 98 to 99% identity and 16S/23S intergenic spacer region has 99% identity to the corresponding region of “Ca. L. asiaticus” in GenBank. These molecular analyses confirm the presence of “Ca. L. asiaticus” in kumquat. Since Huanglongbing has been rarely reported naturally on kumquat, further analysis of this bacterium as a special strain of “Ca. L. asiaticus” is needed. References: (1) M. Garnier et al. Ann. Microbiol. 135A:169, 1984. (2) T. H. Hung et al. J. Phytopathol. 147:599, 1999.

“Candidatus phytoplasma asteris” and related strains (i.e., aster yellows group 16SrI) have been associated with diseases of numerous plant species worldwide. Symptoms of aster yellows (AY) have been reported on rapeseed/canola (Brassica napus and B. rapa) crops in Saskatchewan (SK) and Manitoba, Canada since 1953 (2). Symptoms generally include stunting, virescence, leaf yellowing or purpling, phyllody, and formation of bladder-like siliques. A total of 120 mature B. rapa cv. AC Sunbeam plants exhibiting AY symptoms were collected in commercial fields near Medstead, SK during 2003 and 2004 (one field per year). As described previously (4), total genomic DNA was extracted from leaf, stem, roots, and seeds collected from the 120 plants, from seeds from the seed lots sown in 2003 and 2004, and from leaf and stem tissue of 20 greenhouse-grown plants from each seed lot. The latter DNA samples were assayed for phytoplasma DNA by a nested polymerase chain reaction (PCR) assay incorporating phytoplasma universal 16S rRNA primer pairs P1/P6 (1) followed by R16R2/R16F2 (4). Seed samples analyzed from the 2003 and 2004 seed lots and tissues of the 40 greenhouse-grown plants all tested negative for phytoplasma DNA using this assay. Leaf, stem, and/or root tissues of all plants collected in the field in 2003 (60 plants) and 2004 (60 plants) and 71.1% (315 of 443) of seed samples (five seeds per sample) tested positive for the presence of phytoplasma DNA, as evidenced by the presence of an expected band of 1.2 kb on the gels after the second amplification with primers R16R2/R16F2. Nested PCR products from plant samples collected in 2003 were cloned, sequenced, and compared with phytoplasma sequences archived in the GenBank nucleotide database. On this basis, phytoplasmas detected in plants or their seeds collected in 2003 were found to be most similar (98.8%) to CHRY (Accession No. AY180956), a 16SrI-A subgroup strain, or were most similar (98.9%) to isolate 99UW89 (Accession no. AF268407), a known 16SrI-B subgroup strain. Sequences of phytoplasmas detected in plants or their seeds in 2004 were obtained by direct sequencing of rRNA products amplified from samples using PCR incorporating primer pairs P1/P6 and P4/P7 (3). Analysis of sequence data revealed that phytoplasmas in these plants were all most similar (99.5%) to AY-WB (Accession no. AY389828), a 16SrI-A subgroup member. The nucleotide sequences have been deposited with GenBank under Accession nos. DQ404346, DQ404347, and DQ411470. To our knowledge, this is the first report of 16SrI-A and 16SrI-B subgroup phytoplasmas infecting plants and seed of B. rapa in Saskatchewan. References: (1) I.-M. Lee et al. Phytopathology, 83:834, 1993. (2) W. E. Sackston. Can. Plant Dis. Surv. 33:41, 1953. (3) L. B. Sharmila et al. J. Plant Biochem. Biotech. 13:1, 2004. (4) E. Tanne et al. Phytopathology, 91:741, 2001.

Although no loss of crown shape or unusual growth were evident on two mature Chinaberry trees (Melia azedarach L.) located near the citadel in central Hué city, Vietnam, leaves on both trees displayed distinctive interveinal yellowing during September 2003. This symptom was reminiscent in appearance to foliar discoloration previously observed on mature Chinaberry trees in El Torno, Santa Cruz, Bolivia that was subsequently attributed to phytoplasma infection of these trees (2). Eight samples of yellowed leaves were collected from affected trees and preserved by pressing and drying for later analysis. Total nucleic acids were extracted from 0.5 g of each leaf sample and assayed for phytoplasma DNA using a polymerase chain reaction (PCR) assay with phytoplasma universal rRNA primer pair P1 and P7 (4). No visible product was generated from any Chinaberry sample while a product of expected size (1.8 kb) was obtained from DNA of a periwinkle plant (Catharanthus roseus (L.) G. Don) infected with “Candidatus Phytoplasma asteris”-related strain eastern aster yellows (EAY) and included as a known positive control in the assay. After P1/P7-primed products were reamplified by PCR with nested phytoplasma universal 16S rRNA primer pair R16mF2/R16mR1 (1), a 1.4-kb product of predicted size was obtained from the eight samples and EAY positive control, whereas no product was obtained from DNA of seed-grown healthy periwinkle included as a negative control. Digests of nested PCR products (1.4 kb) with HaeIII or MseI endonuclease, and electrophoresis of digests through 8% polyacrylamide gels, revealed no apparent differences in restriction fragment patterns among products from Chinaberry samples. However, HaeIII and MseI patterns differed from those obtained by digestion of nested PCR products from EAY, a known 16SrI-A subgroup phytoplasma (3), with these enzymes. Chinaberry phytoplasmas were definitively identified as group 16SrI strains after reevaluation of samples by a PCR incorporating ribosomal protein (rp) gene primer pair rpF1/rpR1 and reamplification of resulting products with nested 16SrI group-specific primer pair rp(I)F1A/rp(I)R1A (3). A 1.2-kb product of expected size was obtained from all Chinaberry samples and EAY positive control only. Restriction fragment length polymorphism patterns produced by DraI or SspI endonuclease digests of nested PCR products (1.2 kb) revealed no differences among Chinaberry samples, although patterns associated with each enzyme differed from those observed for the EAY positive control. Sequence comparison and phylogenetic analysis of Chinaberry yellows phytoplasma (CbY-V) 16Sr DNA (GenBank Accession No. AY863003) determined this strain to be most closely related (99.65%) to Epilobium phyllody phytoplasma, a 16SrI-B subgroup strain (3). However, based on analysis of rp gene sequences (GenBank Accession No. DQ321823), strain CbY-V was judged most similar (99.59%) to cabbage proliferation, a well characterized 16SrI-B subgroup, rpI-B subgroup phytoplasma (3). To our knowledge, this is the first record of phytoplasma infection of Chinaberry, a common urban shade tree in Vietnam. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) N. A. Harrison et al. Plant Pathol. 52:147, 2003. (3) I.-M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:1037, 2004 (4) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996.

Huanglongbing (HLB) (ex-greening) is one of the most serious diseases of citrus. The causal agent is a noncultured, sieve tube-restricted α-proteobacterium, “Candidatus Liberibacter africanus” in Africa and “Candidatus Liberibacter asiaticus” in Asia (2). The disease has never been reported from the American continent. However, Diaphorina citri, the Asian psyllid vector of HLB, is found in South, Central, and North America (Florida and Texas). Early in 2004, leaf and fruit symptoms resembling those of HLB were observed in several sweet orange orchards near the city of Araraquara, Sao Paulo State. Leaf mottling on small and large leaves was the major symptom. Shoots with affected leaves were yellowish. Fruits were small and lopsided, contained many aborted seeds, and appeared more severely affected than were plants infected with classic HLB. Forty-three symptomatic samples and twenty-five samples of symptomless sweet orange leaves from five farms were analyzed for the presence of the HLB-liberibacters using polymerase chain reaction (PCR) with two sets of HLB-specific primers for amplification of 16S rDNA (2,3) and ribosomal protein genes (1). None of the 43 symptomatic leaf samples gave a positive PCR amplification, while HLB-affected leaves from the Bordeaux HLB collection produced the characteristic amplicons with both sets of primers. The 43 symptomatic and the 25 symptomless leaf samples were then analyzed using PCR with universal primers for amplification of bacterial 16S rDNA (4). All symptomatic leaf samples, but none of the symptomless leaf samples, yielded the same 16S rDNA amplification product, indicating the presence of a bacterium in the symptomatic leaves. This was confirmed using the observation of a sieve tube restricted bacterium by electron microscopy. The 16S rDNA product was cloned, sequenced, and compared with those of “Ca. L. africanus” and “Ca. L. asiaticus”. While the 16S rDNAs of these two liberibacter species have 97.5% sequence identity, the 16S rDNA sequence of the new bacterium shared only 93.7% identity with that of “Ca. L. asiaticus” and 93.9% with that of “Ca. L. africanus”. The 16S rDNA sequence of the new bacterium had a secondary loop structure characteristic of the α subdivision of the proteobacteria and possessed all the oligonucleotide signatures characteristic of the liberibacters. For these reasons, the new bacterium is a liberibacter and is sufficiently different phylogenetically from known liberibacters to warrant a new species, “Candidatus Liberibacter americanus”. Specific PCR primers for amplification of the 16S rDNA of the new species have been developed. They were able to detect “Ca. L. americanus” in 214 symptomatic leaf samples from 47 citrus farms in 35 municipalities, while the “old” species, “Ca. L. asiaticus”, has been found only four times within the 47 farms. References: (1) A. Hocquellet et al. Mol. Cell. Probes, 13:373, 1999. (2) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Huanglongbing (ex-greening) disease is one of the most serious diseases of citrus. It is caused by the phloem-limited, gram-negative bacterium “Candidatus Liberibacter spp.”. This bacterium is not well characterized mainly because it is still uncultured. There are two known strains, Asian (“Candidatus Liberibacter asiaticus”) and African (“Candidatus Liberibacter africanus”) that cause severe damage to citrus plants including twig dieback, decline, and death. Symptoms first appear as leaf mottling and chlorosis occurring in one shoot or sector of trees. Later, leaf symptoms resemble nutritional deficiencies (Zn, Ca, and N) that vary depending on the strains, with more severe symptoms caused by “Ca. L. asiaticus”. The Asian strains are transmitted by the Asian citrus psyllid (AsCP), Diaphorina citri, which is present in Brazil. The bacterium has been detected in citrus plants in many geographic locations including China, Japan, Thailand, India, the Philippines, the Arabian Peninsula, and Africa. In 2004, plants showing Huanglongbing symptoms were observed in the Araraquara County, a central region of the State of Sao Paulo, the largest citrus-producing area in Brazil. To verify the presence of “Ca. L. spp.” in these plants, leaf samples of sweet orange cvs. Hamlin and Valencia were used for DNA extraction and polymerase chain reaction amplification using the specific OI1 and Oi2c primers (1). Amplification of the 16S rDNA was positive for 2 (cvs. Hamlin and Valencia) of 10 analyzed plants. The amplified fragments were cloned and sequenced. The amplicons obtained from both plants showed the same sequence, which differed from “Ca. L. africanus”, utilized as the positive control in the amplification experiment (27 divergent bases in 1,160). The sequences were used for BLAST searches, and the results showed identities ranging from 94.71 to 100% with “Ca. L. spp.” sequences available at the National Center for Biotechnology Information database (on-line publication). The highest scores were obtained with “Ca. L. asiaticus sequences. These analyses confirmed the presence of such agent in the State of Sao Paulo. To our knowledge, this is the first report of “Ca. L. asiaticus” in Brazil as well as elsewhere in the Americas. The significance of this report relates to the potential damage that this pathogen could cause to the citrus industry in the largest citrus-producing country in the world. It remains unclear how and when the pathogen entered Brazil. Reference: (1) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996.

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Mandarin (Citrus reticulata) is the most important cash crop in Bhutan and plantations total approximately 1.8 million trees (Ministry of Agriculture, Thimphu, Bhutan, 2000). Most trees are a local mandarin variety. Seedlings trees are produced by local farmers or supplied by Druk Seed Nursery. Mandarin seedlings have also been introduced from India. In the mid-1990s, mandarin trees growing in Punakha Valley and Wangdue districts began showing symptoms of decline that included sparse yellow foliage and shoot die-back. After initial surveys in 2000, huanglongbing (HLB) was suspected as the cause of declining trees based on symptomatology and presence of the psyllid vector Diaphorina citri, but no confirmatory tests were carried out. In August 2002, we surveyed eight locations in the valley from Rimchu (North) to Kamichu (South). HLB-like leaf mottle symptoms were observed on declining mandarin trees at all locations at altitudes ranging from 700 to 1,450 m. Orchards around Punakha (1,350m) in the center of the valley were more severely affected. Symptoms were also observed on Mexican lime (Citrus aurantifolia), citron (Citrus medica), and on tangelo trees (Minneola, Seminola, and Iyo) introduced originally as certified HLB-free budwoods from Corsica, France and grafted onto Rangpur lime at the Wangdue Research Center (1,300m). Leaves were collected from symptomatic trees and three declining mandarin trees without characteristic leaf mottle symptoms. Two specific polymerase chain reaction (PCR) tests for the detection of HLB Liberibacter species (1,2) were carried out on 16 DNA samples extracted from leaf mid-veins of 10 mandarins, two Mexican limes, three tangelos, and one citron tree. “Candidatus Liberibacter asiaticus” was readily detected by both PCR assays in all but two samples (one mandarin with noncharacteristic symptoms and citron) and all sampled orchards. The presence in the Wangdue Research Center of liberibacter infected trees, propagated from certified HLB-free budwoods, suggests that natural spread of the HLB by D. citri is occuring, as the psyllid had been identified previously in the Punakha area by Bhutanese Entomologists. It is likely that the disease was originally introduced as infected planting material although its source has not been determined. References: (1) A. Hocquellet et al. Mol. Cell. Probes 13:373, 1999. (2) S. Jagoueix et al. Mol. Cell.Probes 10:43,1996.