Plant Disease

Although no loss of crown shape or unusual growth were evident on two mature Chinaberry trees (Melia azedarach L.) located near the citadel in central Hué city, Vietnam, leaves on both trees displayed distinctive interveinal yellowing during September 2003. This symptom was reminiscent in appearance to foliar discoloration previously observed on mature Chinaberry trees in El Torno, Santa Cruz, Bolivia that was subsequently attributed to phytoplasma infection of these trees (2). Eight samples of yellowed leaves were collected from affected trees and preserved by pressing and drying for later analysis. Total nucleic acids were extracted from 0.5 g of each leaf sample and assayed for phytoplasma DNA using a polymerase chain reaction (PCR) assay with phytoplasma universal rRNA primer pair P1 and P7 (4). No visible product was generated from any Chinaberry sample while a product of expected size (1.8 kb) was obtained from DNA of a periwinkle plant (Catharanthus roseus (L.) G. Don) infected with “Candidatus Phytoplasma asteris”-related strain eastern aster yellows (EAY) and included as a known positive control in the assay. After P1/P7-primed products were reamplified by PCR with nested phytoplasma universal 16S rRNA primer pair R16mF2/R16mR1 (1), a 1.4-kb product of predicted size was obtained from the eight samples and EAY positive control, whereas no product was obtained from DNA of seed-grown healthy periwinkle included as a negative control. Digests of nested PCR products (1.4 kb) with HaeIII or MseI endonuclease, and electrophoresis of digests through 8% polyacrylamide gels, revealed no apparent differences in restriction fragment patterns among products from Chinaberry samples. However, HaeIII and MseI patterns differed from those obtained by digestion of nested PCR products from EAY, a known 16SrI-A subgroup phytoplasma (3), with these enzymes. Chinaberry phytoplasmas were definitively identified as group 16SrI strains after reevaluation of samples by a PCR incorporating ribosomal protein (rp) gene primer pair rpF1/rpR1 and reamplification of resulting products with nested 16SrI group-specific primer pair rp(I)F1A/rp(I)R1A (3). A 1.2-kb product of expected size was obtained from all Chinaberry samples and EAY positive control only. Restriction fragment length polymorphism patterns produced by DraI or SspI endonuclease digests of nested PCR products (1.2 kb) revealed no differences among Chinaberry samples, although patterns associated with each enzyme differed from those observed for the EAY positive control. Sequence comparison and phylogenetic analysis of Chinaberry yellows phytoplasma (CbY-V) 16Sr DNA (GenBank Accession No. AY863003) determined this strain to be most closely related (99.65%) to Epilobium phyllody phytoplasma, a 16SrI-B subgroup strain (3). However, based on analysis of rp gene sequences (GenBank Accession No. DQ321823), strain CbY-V was judged most similar (99.59%) to cabbage proliferation, a well characterized 16SrI-B subgroup, rpI-B subgroup phytoplasma (3). To our knowledge, this is the first record of phytoplasma infection of Chinaberry, a common urban shade tree in Vietnam. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) N. A. Harrison et al. Plant Pathol. 52:147, 2003. (3) I.-M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:1037, 2004 (4) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996.

Huanglongbing (HLB) (ex-greening) is one of the most serious diseases of citrus. The causal agent is a noncultured, sieve tube-restricted α-proteobacterium, “Candidatus Liberibacter africanus” in Africa and “Candidatus Liberibacter asiaticus” in Asia (2). The disease has never been reported from the American continent. However, Diaphorina citri, the Asian psyllid vector of HLB, is found in South, Central, and North America (Florida and Texas). Early in 2004, leaf and fruit symptoms resembling those of HLB were observed in several sweet orange orchards near the city of Araraquara, Sao Paulo State. Leaf mottling on small and large leaves was the major symptom. Shoots with affected leaves were yellowish. Fruits were small and lopsided, contained many aborted seeds, and appeared more severely affected than were plants infected with classic HLB. Forty-three symptomatic samples and twenty-five samples of symptomless sweet orange leaves from five farms were analyzed for the presence of the HLB-liberibacters using polymerase chain reaction (PCR) with two sets of HLB-specific primers for amplification of 16S rDNA (2,3) and ribosomal protein genes (1). None of the 43 symptomatic leaf samples gave a positive PCR amplification, while HLB-affected leaves from the Bordeaux HLB collection produced the characteristic amplicons with both sets of primers. The 43 symptomatic and the 25 symptomless leaf samples were then analyzed using PCR with universal primers for amplification of bacterial 16S rDNA (4). All symptomatic leaf samples, but none of the symptomless leaf samples, yielded the same 16S rDNA amplification product, indicating the presence of a bacterium in the symptomatic leaves. This was confirmed using the observation of a sieve tube restricted bacterium by electron microscopy. The 16S rDNA product was cloned, sequenced, and compared with those of “Ca. L. africanus” and “Ca. L. asiaticus”. While the 16S rDNAs of these two liberibacter species have 97.5% sequence identity, the 16S rDNA sequence of the new bacterium shared only 93.7% identity with that of “Ca. L. asiaticus” and 93.9% with that of “Ca. L. africanus”. The 16S rDNA sequence of the new bacterium had a secondary loop structure characteristic of the α subdivision of the proteobacteria and possessed all the oligonucleotide signatures characteristic of the liberibacters. For these reasons, the new bacterium is a liberibacter and is sufficiently different phylogenetically from known liberibacters to warrant a new species, “Candidatus Liberibacter americanus”. Specific PCR primers for amplification of the 16S rDNA of the new species have been developed. They were able to detect “Ca. L. americanus” in 214 symptomatic leaf samples from 47 citrus farms in 35 municipalities, while the “old” species, “Ca. L. asiaticus”, has been found only four times within the 47 farms. References: (1) A. Hocquellet et al. Mol. Cell. Probes, 13:373, 1999. (2) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Huanglongbing (ex-greening) disease is one of the most serious diseases of citrus. It is caused by the phloem-limited, gram-negative bacterium “Candidatus Liberibacter spp.”. This bacterium is not well characterized mainly because it is still uncultured. There are two known strains, Asian (“Candidatus Liberibacter asiaticus”) and African (“Candidatus Liberibacter africanus”) that cause severe damage to citrus plants including twig dieback, decline, and death. Symptoms first appear as leaf mottling and chlorosis occurring in one shoot or sector of trees. Later, leaf symptoms resemble nutritional deficiencies (Zn, Ca, and N) that vary depending on the strains, with more severe symptoms caused by “Ca. L. asiaticus”. The Asian strains are transmitted by the Asian citrus psyllid (AsCP), Diaphorina citri, which is present in Brazil. The bacterium has been detected in citrus plants in many geographic locations including China, Japan, Thailand, India, the Philippines, the Arabian Peninsula, and Africa. In 2004, plants showing Huanglongbing symptoms were observed in the Araraquara County, a central region of the State of Sao Paulo, the largest citrus-producing area in Brazil. To verify the presence of “Ca. L. spp.” in these plants, leaf samples of sweet orange cvs. Hamlin and Valencia were used for DNA extraction and polymerase chain reaction amplification using the specific OI1 and Oi2c primers (1). Amplification of the 16S rDNA was positive for 2 (cvs. Hamlin and Valencia) of 10 analyzed plants. The amplified fragments were cloned and sequenced. The amplicons obtained from both plants showed the same sequence, which differed from “Ca. L. africanus”, utilized as the positive control in the amplification experiment (27 divergent bases in 1,160). The sequences were used for BLAST searches, and the results showed identities ranging from 94.71 to 100% with “Ca. L. spp.” sequences available at the National Center for Biotechnology Information database (on-line publication). The highest scores were obtained with “Ca. L. asiaticus sequences. These analyses confirmed the presence of such agent in the State of Sao Paulo. To our knowledge, this is the first report of “Ca. L. asiaticus” in Brazil as well as elsewhere in the Americas. The significance of this report relates to the potential damage that this pathogen could cause to the citrus industry in the largest citrus-producing country in the world. It remains unclear how and when the pathogen entered Brazil. Reference: (1) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996.

Mandarin (Citrus reticulata) is the most important cash crop in Bhutan and plantations total approximately 1.8 million trees (Ministry of Agriculture, Thimphu, Bhutan, 2000). Most trees are a local mandarin variety. Seedlings trees are produced by local farmers or supplied by Druk Seed Nursery. Mandarin seedlings have also been introduced from India. In the mid-1990s, mandarin trees growing in Punakha Valley and Wangdue districts began showing symptoms of decline that included sparse yellow foliage and shoot die-back. After initial surveys in 2000, huanglongbing (HLB) was suspected as the cause of declining trees based on symptomatology and presence of the psyllid vector Diaphorina citri, but no confirmatory tests were carried out. In August 2002, we surveyed eight locations in the valley from Rimchu (North) to Kamichu (South). HLB-like leaf mottle symptoms were observed on declining mandarin trees at all locations at altitudes ranging from 700 to 1,450 m. Orchards around Punakha (1,350m) in the center of the valley were more severely affected. Symptoms were also observed on Mexican lime (Citrus aurantifolia), citron (Citrus medica), and on tangelo trees (Minneola, Seminola, and Iyo) introduced originally as certified HLB-free budwoods from Corsica, France and grafted onto Rangpur lime at the Wangdue Research Center (1,300m). Leaves were collected from symptomatic trees and three declining mandarin trees without characteristic leaf mottle symptoms. Two specific polymerase chain reaction (PCR) tests for the detection of HLB Liberibacter species (1,2) were carried out on 16 DNA samples extracted from leaf mid-veins of 10 mandarins, two Mexican limes, three tangelos, and one citron tree. “Candidatus Liberibacter asiaticus” was readily detected by both PCR assays in all but two samples (one mandarin with noncharacteristic symptoms and citron) and all sampled orchards. The presence in the Wangdue Research Center of liberibacter infected trees, propagated from certified HLB-free budwoods, suggests that natural spread of the HLB by D. citri is occuring, as the psyllid had been identified previously in the Punakha area by Bhutanese Entomologists. It is likely that the disease was originally introduced as infected planting material although its source has not been determined. References: (1) A. Hocquellet et al. Mol. Cell. Probes 13:373, 1999. (2) S. Jagoueix et al. Mol. Cell.Probes 10:43,1996.

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Catharanthus roseus (L.) G. Don (periwinkle) is well known as an experimental host for diverse phytoplasmas that are artificially transmitted to it through the use of dodder (Cuscuta sp.), laboratory vector insects, or grafting. However, few phytoplasma taxa have been reported in natural infections of C. roseus, and the role of C. roseus in phytoplasma dissemination and natural disease spread is not clear. In this study, naturally diseased plants of C. roseus exhibiting yellowing and witches' broom symptoms indicative of phytoplasma infection were observed throughout the year in the state of Rio de Janeiro, Brazil. Shoots and leaves of four diseased plants were assayed for the presence of phytoplasma DNA sequences by nested polymerase chain reactions (PCR) as previously described (2,3). Phytoplasma rDNA was amplified from diseased periwinkle plants in PCR primed by primer pair P1/P7 and was reamplified in nested PCR primed by primer pair R16F2n/R16R2 (F2n/R2). The results indicated the presence of phytoplasma in all four diseased plants. Phytoplasma identification was accomplished by restriction fragment length polymorphism (RFLP) analysis, using 11 restriction enzymes, of 16S rDNA amplified in PCR primed by F2n/R2. Phytoplasmas were classified according to the system of Lee et al. (1). On the basis of collective RFLP patterns of 16S rDNA, the phytoplasma infections in the four periwinkle plants could not be distinguished from one another. Furthermore, the collective RFLP patterns were indistinguishable from those reported previously for hibiscus witches' broom phytoplasma, “Candidatus Phytoplasma brasiliense” (2). The phytoplasma found in C. roseus, designated strain HibWB-Cr, was classified in group 16SrXV (hibiscus witches' broom phytoplasma group). HibWB-Cr is tentatively considered a new strain of “Ca. P. brasiliense”. C. roseus is the first known, naturally diseased alternate plant host of “Ca. P. brasiliense”. The present study identified strain HibWB-Cr in Rio de Janeiro State, where hibiscus witches' broom disease is prevalent (2). How this economically important disease of hibiscus spreads is not known. Our findings raise the possibility that a polyphagous insect vector is involved in the natural transmission of “Ca. P. brasiliense” and that C. roseus or other plant species serve as reservoirs for the spread of this phytoplasma taxon. References: (1) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) H. G. Montano et al. Int. J. Syst. Evol. Microbiol. 51:1109, 2001. (3) H. G. Montano et al. Plant Dis. 84:429, 1999.