Plant Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Mandarin (Citrus reticulata) is the most important cash crop in Bhutan and plantations total approximately 1.8 million trees (Ministry of Agriculture, Thimphu, Bhutan, 2000). Most trees are a local mandarin variety. Seedlings trees are produced by local farmers or supplied by Druk Seed Nursery. Mandarin seedlings have also been introduced from India. In the mid-1990s, mandarin trees growing in Punakha Valley and Wangdue districts began showing symptoms of decline that included sparse yellow foliage and shoot die-back. After initial surveys in 2000, huanglongbing (HLB) was suspected as the cause of declining trees based on symptomatology and presence of the psyllid vector Diaphorina citri, but no confirmatory tests were carried out. In August 2002, we surveyed eight locations in the valley from Rimchu (North) to Kamichu (South). HLB-like leaf mottle symptoms were observed on declining mandarin trees at all locations at altitudes ranging from 700 to 1,450 m. Orchards around Punakha (1,350m) in the center of the valley were more severely affected. Symptoms were also observed on Mexican lime (Citrus aurantifolia), citron (Citrus medica), and on tangelo trees (Minneola, Seminola, and Iyo) introduced originally as certified HLB-free budwoods from Corsica, France and grafted onto Rangpur lime at the Wangdue Research Center (1,300m). Leaves were collected from symptomatic trees and three declining mandarin trees without characteristic leaf mottle symptoms. Two specific polymerase chain reaction (PCR) tests for the detection of HLB Liberibacter species (1,2) were carried out on 16 DNA samples extracted from leaf mid-veins of 10 mandarins, two Mexican limes, three tangelos, and one citron tree. “Candidatus Liberibacter asiaticus” was readily detected by both PCR assays in all but two samples (one mandarin with noncharacteristic symptoms and citron) and all sampled orchards. The presence in the Wangdue Research Center of liberibacter infected trees, propagated from certified HLB-free budwoods, suggests that natural spread of the HLB by D. citri is occuring, as the psyllid had been identified previously in the Punakha area by Bhutanese Entomologists. It is likely that the disease was originally introduced as infected planting material although its source has not been determined. References: (1) A. Hocquellet et al. Mol. Cell. Probes 13:373, 1999. (2) S. Jagoueix et al. Mol. Cell.Probes 10:43,1996.

Catharanthus roseus (L.) G. Don (periwinkle) is well known as an experimental host for diverse phytoplasmas that are artificially transmitted to it through the use of dodder (Cuscuta sp.), laboratory vector insects, or grafting. However, few phytoplasma taxa have been reported in natural infections of C. roseus, and the role of C. roseus in phytoplasma dissemination and natural disease spread is not clear. In this study, naturally diseased plants of C. roseus exhibiting yellowing and witches' broom symptoms indicative of phytoplasma infection were observed throughout the year in the state of Rio de Janeiro, Brazil. Shoots and leaves of four diseased plants were assayed for the presence of phytoplasma DNA sequences by nested polymerase chain reactions (PCR) as previously described (2,3). Phytoplasma rDNA was amplified from diseased periwinkle plants in PCR primed by primer pair P1/P7 and was reamplified in nested PCR primed by primer pair R16F2n/R16R2 (F2n/R2). The results indicated the presence of phytoplasma in all four diseased plants. Phytoplasma identification was accomplished by restriction fragment length polymorphism (RFLP) analysis, using 11 restriction enzymes, of 16S rDNA amplified in PCR primed by F2n/R2. Phytoplasmas were classified according to the system of Lee et al. (1). On the basis of collective RFLP patterns of 16S rDNA, the phytoplasma infections in the four periwinkle plants could not be distinguished from one another. Furthermore, the collective RFLP patterns were indistinguishable from those reported previously for hibiscus witches' broom phytoplasma, “Candidatus Phytoplasma brasiliense” (2). The phytoplasma found in C. roseus, designated strain HibWB-Cr, was classified in group 16SrXV (hibiscus witches' broom phytoplasma group). HibWB-Cr is tentatively considered a new strain of “Ca. P. brasiliense”. C. roseus is the first known, naturally diseased alternate plant host of “Ca. P. brasiliense”. The present study identified strain HibWB-Cr in Rio de Janeiro State, where hibiscus witches' broom disease is prevalent (2). How this economically important disease of hibiscus spreads is not known. Our findings raise the possibility that a polyphagous insect vector is involved in the natural transmission of “Ca. P. brasiliense” and that C. roseus or other plant species serve as reservoirs for the spread of this phytoplasma taxon. References: (1) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) H. G. Montano et al. Int. J. Syst. Evol. Microbiol. 51:1109, 2001. (3) H. G. Montano et al. Plant Dis. 84:429, 1999.