Publications

4364

Abstract Citrus greening disease, also known as huanglongbing (HLB), is caused by the gram-negative α-proteobacteria Candidatus Liberibacter species. This disease poses a significant threat to citrus production worldwide, including in Nepal. This study aimed to conduct the diagnosis and phylogenetic analysis of the citrus greening pathogen in Nepal using both conventional PCR and computational methods. A total of 1,026 samples were collected from thirteen districts across six provinces in the country. PCR-based diagnosis was performed using the primer set Las606/LSS, which targets the 16S rRNA gene of Candidatus Liberibacter asiaticus. Additionally, 16S rRNA gene sequencing was performed using sanger sequencing for five samples collected from different geographical regions. The obtained sequences were deposited in GenBank, and a phylogenetic tree was constructed based on these sequences. Among the 1,026 samples tested, 255 were positive, indicating the widespread distribution of HLB across Nepal. All consensus sequences from Nepal showed strong evolutionary relatedness within the C. L. asiaticus cluster, displayed over 99% genetic similarity with reference sequences from various parts of the world. Phylogenetic analysis revealed that the Nepalese sequences were closely related to C. L. asiaticus sequences from India, such as OM522080.1 (Punjab) and MH473394.1 (Meerut). Additionally, sequences obtained from different regions of Nepal clustered closely together. The findings of this research provide valuable insights into the genetic diversity and prevalence of citrus greening disease, which will aid the development of better management strategies to combat this devastating disease. Furthermore, the sequence data deposited in GenBank will serve as a key reference for future molecular studies on citrus greening disease.

The X-disease phytoplasma (‘Candidatus Phytoplasma pruni’) is an obligate pathogen that is capable of infection, persistence, and pathogenicity in both its major plant host (Prunus spp.) and leafhopper vector (Colladonus spp.) species. How the ‘Ca. P. pruni’ interacts with its plant and insect hosts, and how it alters its gene expression to do so is unknown, therefore in this study we conducted comparative RNAseq and differential gene expression analysis on ‘Ca. P. pruni’ infected P. avium and C. reductus samples. We found that the phytoplasma altered expression of approximately 32% of its annotated protein coding and pseudogenes, including intercellular transporters, proteolytic activity, its membrane structure, as well as upregulating genes associated with potential mobile units when in insect tissues vs. in plant tissues. Most notably, differential expression was observed in genes that were identified by in silico analysis as being putative secreted effectors that may play a role in allowing phytoplasma infection and survival in these two very different host systems, as well as inducing X-disease in Prunus spp., and offers targets for control by of this damaging pathogen by disrupting phytoplasma-host interactions.

Okra (Abelmoschus esculentus) was cultivated on 1,342 hectares in the United States in 2023, producing 10,540 tonnes (FAOSTAT). During a field survey conducted in 2023, a single okra plant in a plot (roughly 0.1 acre) cultivated in Tulsa County, Oklahoma, displayed symptoms of virescence, phyllody, and witches’-broom. Leaf tissues were collected from one symptomatic (sample K7) and three asymptomatic plants. Total RNA and genomic DNA were extracted using the Plant RNA Isolation Kit (Norgen Biotek Corp, Ontario, Canada) and Plant DNA Kit (Omega BIO-TEK). RNA from the samples was subjected to high-throughput sequencing (HTS) on the NovaSeq X Plus at the Oklahoma Medical Research Foundation. After trimming, 16,454,026 reads (average length = 151 bp) were de novo assembled using CLC Genomics Workbench v22.0.1 (QIAGEN) and analysed via BLASTn and BLASTx analyses against the NCBI GenBank (nr) database. Thirty-six contigs (205-664 bp) showed similarity to the ‘Candidatus Phytoplasma 16SrI group with an average coverage ranging from 1.6 to 118.1X. Later in the season, disease progression was observed on the same plant (K7), and additional symptomatic leaf tissues were collected and processed as described above. The second HTS run yielded 53,701,463 reads (average length = 130 bp). De novo assembly produced 617 contigs (190-15,179 bp), matching ‘Candidatus Phytoplasma asteris’ (rapeseed phyllody phytoplasma, CP055264) with coverage ranging from 2.04 to 23,516.25X. Raw sequencing reads were deposited in the NCBI database under the Sequence Read Archive (SRA) SRR32988524. To confirm the HTS results, PCR was performed using DNA from the K7 sample and healthy okra plants, with two primer sets designed from HTS-derived contigs (1F CTCATCCTGTAAGCGTTGCC, 1R AGCGGCTTTGATGTTGGATC (446 bp), and 2F CCAAACCGCAGTGCTAACAT, 2R GTTTTGACCCCACGAGCTTT (product size 524-bp). Both expected amplicons (446 and 524 bp, respectively) were detected in the symptomatic sample (K7) but none in the asymptomatic sample. Sanger sequencing and BLASTn of the PCR products confirmed 99.03% and 99.8% nucleotide identity to the rapeseed phyllody phytoplasma isolate RP166 (GenBank accession CP055264). Additionally, the full-length 16S rRNA gene (1,521 bp) retrieved from HTS data revealed 99.8% identity with the same isolate. Based on the iPhyClassifier analysis (Wei et al. 2007; Zhao et al. 2009), the phytoplasma strain was classified as ‘Candidatus Phytoplasma asteris’ subgroup 16Srl-B. ‘Candidatus Phytoplasma asteris’ has been previously associated with phyllody in oilseed rape in Poland (Zwolińska et al. 2011), rapeseed phyllody disease (Cho et al. 2020), little leaf disease of cotton and luffa in India (Kumar et al. 2010), tomato stunt in Cuba (Zamora et al. 2014) and other crop diseases. This study presents the first confirmed report of rapeseed phyllody phytoplasma infecting okra in Oklahoma, and United States. Okra is a significant cash crop for both small and large-scale farmers and widely cultivated vegetable in Oklahoma and various other states across the United States. It has numerous nutritional benefits (vitamins, minerals, dietary fibre and antioxidants) in the human diet and traditional medicine. Okra is susceptible to various diseases. Therefore, conducting a comprehensive survey of okra fields is crucial to identify potential disease threats and to implement effective measures for the protection and sustainability of this important crop.

A Gram-negative, facultative anaerobic, rod-shaped, motile with peritrichous flagella, fluorescent bacterium, designated ‘Candidatus Pseudomonas auctus’ sp. nov. JDE115, was isolated from soybean root nodules in Virginia and characterized using a comprehensive integrative methodology. Growth of JDE115 occurred with 0–5.0% (w/v) NaCl (optimum 1%), at pH 6.0–10.0 (optimum pH 7.0), and at 10–40°C (optimum 28°C) in LB broth. Phylogenetic analyses based on the 16S rRNA gene placed the isolate as a member of a novel species within the genus Pseudomonas. Phylogenetic analyses based on whole-genome sequences, 16S rRNA, showed JDE115 having the highest similarity to Pseudomonas glycinae MS586. Average Nucleotide Identity (ANI) analysis also revealed the highest similarity of JDE115 to Pseudomonas glycinae MS586 (94.59%), which is below the 95% threshold for species delineation. Genome-to-genome distance analysis (GGDC, Formula 2) showed a maximum value of 57.10% with the same strain, far below the 70% cutoff. The primary isoprenoid quinone detected in JDE115 was ubiquinone-9 (Q-9) and the DNA G + C content was 60.68 mol%. The whole-cell fatty acid profile was dominated by C16:0, C17:0 cyclo, and the summed features 3 (C16:1ω7c and/or C16:1ω6c) and 8 (C18:1ω7c and/or C18:1ω6c). Additional fatty acids detected included 12:0, 14:0, and 18:0. Based on these phenotypic, chemotaxonomic, and phylogenetic data, strain JDE115 is proposed to represent a new species in the genus Pseudomonas, for which the name ‘Candidatus Pseudomonas auctus’ sp. nov. is proposed.

‘Candidatus Phytoplasma solani’ is the causal agent of the Bois noir (BN), affecting grapevine worldwide. The complex epidemiology of BN, which involves multiple ‘Ca. P. solani’ host plants and insect vectors, as well as the occurrence of recovery (loss of symptoms on grapevine canopy), makes disease investigations and containment in vineyards difficult. To achieve early detection of ‘Ca. P. solani’, a droplet digital PCR (ddPCR)-based approach and quantitative (q)PCR assay were compared, testing specific primers based on the elongation factor Tu (tuf) gene using SYBR Green chemistry. The regression curve analysis of the ddPCR assay showed good linearity. Compared with the qPCR method, the sensitivity of ddPCR improved about 10-fold. The analysis of grapevine roots spiked with serial dilutions of ‘Ca P. solani’. PCR tuf fragments showed that qPCR was inhibited, while ddPCR was not affected. Testing 66 grapevine samples from 50 grapevine plants, the ddPCR provided superior diagnostic performance compared to qPCR in roots of symptomatic plants (75% detected by ddPCR, 41.6% by qPCR), roots of recovered plants (58.8% detected by ddPCR, 25% by qPCR), and asymptomatic leaf tissues from recovered plants (75% detected by ddPCR, 25% by qPCR). The ddPCR analysis allowed us to detect ‘Ca. P. solani’ on 40% of leaf samples from recovered plants and 20% of roots from asymptomatic plants. No differences among ddPCR and qPCR were found in detecting phytoplasma on symptomatic leaf samples. The ddPCR assay allowed the absolute quantification of ‘Ca. P. solani’ in complex matrices, such as roots, and when low titer of phytoplasma is present.

Psyllids are vectors of fastidious plant pathogenic ‘Candidatus Liberibacter’ species that infect both the psyllid vector and plant host. Understanding the molecular and cellular basis of ‘Ca. Liberibacter’ interactions with the psyllid host will aid in identification of effectors involved in invasion and multiplication and facilitate transmission to the host plant. The differential expression of previously identified genes/loci with predicted involvement in tomato host–plant– ‘Ca. L. solanacearum’–prophage–Wolbachia endosymbiont dynamics was quantified by RT-qPCR amplification. Fifteen ‘Ca. Liberibacter solanacearum genes and/or prophage loci and four predicted Wolbachia spp. loci were analyzed in potato psyllids in a 14-day time-course study, post-48-h acquisition-access period by potato psyllids on ‘Ca. L. solanacearum’-infected tomato plants. The ‘Ca. L. solanacearum’-infected tomato host plants were used as an infected host ‘calibrator’ species lacking involvement of psyllid effectors. ‘Ca. L. solanacearum’ genes with predicted functions in adhesion, motility, transport, and virulence that are associated with the prophage lysogenic lifestyle were differentially expressed. In contrast, the prophage-loci expression was synchronous with early or late phase of psyllid-‘Ca. L. solanacearum’ infection, respectively. The observations are consistent with the previously in silico-predicted ‘Ca. L. solanacearum’ gene and prophage/Wolbachia loci functions and time-course global expression patterns. Knockdown of ‘Ca. L. solanacearum’ genes involved in invasion, biofilm formation, and colonization would be expected to impair the vertical and horizontal transmission of ‘Ca. L. solanacearum’ to psyllid offspring and host plants, respectively.

This is a general protocol for the vegetative propagation of citrus material infected with the bacterium Candidatus Liberibacter asiaticus (CLas), the presumed causal agent of citrus greening disease (HLB), using an aeroponic cloning apparatus. The following procedure details a workflow using an EZ-Clone Pro Low Cloning System from Hydrobuilder.com. This system comes in varying cell-sizes (number of clones). We have found the most versatile to be the 16- or 32-cell size based on ease of preparation, keeping algae growth to a minimum, and maintenance. Cloning versus seed sowing has been useful in producing infected material for experimental assays requiring cloned, mature citrus trees as opposed to genetically variable plants from seeds. Where seed germination can take up to 12+ months to achieve plants with stem diameters ≥ 10 mm and 5+ years for flowering, infected branches from flowering trees can be directly propagated using this protocol within a few months and retain their maturity. Clone viability rate differs by citrus cultivar and general health of the cutting used, with citron and CLas negative material having the highest success rate. Infected citron cuttings have had a 95% survival rate, regardless of the diameter of the cutting. The cutting diameter ranged from 2mm-12mm and was limited to 12mm maximum, which is the size of the collar on the EZ-Clone Pro Low cloner.