Publications

4358

ABSTRACT Polyphosphate-accumulating organisms (PAOs) are the main bacteria responsible for phosphorus removal and recovery in full-scale wastewater treatment plants (WWTPs). They encompass members of the genera Candidatus Accumulibacter, Azonexus (formerly Dechloromonas ), and Candidatus Phosphoribacter (formerly Tetrasphaera ), with most studies focusing on Ca . Accumulibacter, primarily using lab-scale enrichment cultures. Although members from the three genera often co-exist in full-scale WWTPs, the metabolic capabilities and traits that determine the niche differentiation of the specific species are still unknown. We retrieved 214 high-quality metagenome-assembled genomes from a full-scale plant with phosphorus removal and examined the polyphosphate-related metabolic pathways using genome-resolved metatranscriptomics in the different process tanks in situ and by using short-term incubations ex situ . We observed the co-existence of nine uncultured PAO species from the three genera with clear niche differentiation in the utilization of different carbon sources and involvement in the denitrification process. Additionally, we observed several physiological differences among species of the same genus, indicating variations in niche specialization. This suggests that biological P removal and other processes in full-scale WWTPs are carried out by a complex and diverse PAO community that together ensures stable plant performance. IMPORTANCE The current understanding of the ecology and physiology of polyphosphate-accumulating organisms (PAOs) is mostly based on Candidatus Accumulibacter, primarily studied in enriched lab-scale studies. Recent taxonomic reclassification revealed that the most studied Ca . Accumulibacter species are either not present or present in low abundance in full-scale wastewater treatment plants (WWTPs). This raises concerns that knowledge from lab-scale studies may not apply to species in full-scale plants. Additionally, the indication of a distinct PAO physiology in Candidatus Phosphoribacter compared to Ca . Accumulibacter and the other abundant PAO Ca . Azonexus poses further questions about the accuracy of the current PAO model. Here, we show that in full-scale plant species from Ca . Accumulibacter, Ca . Azonexus, and Ca . Phosphoribacter always co-exist, and they have distinct niche separations in terms of carbon source utilization and the use of electron acceptors. This co-existence and metabolic diversity indicate that a complex microbial community is crucial for efficient phosphorus removal in full-scale WWTPs.

Phytoplasmas (‘Candidatus Phytoplasma’) are intracellular pleomorphic plant pathogens belonging to the class Mollicutes. They colonize both plant hosts and insect vectors in their life cycle. Apple proliferation (AP) is one of the most important phytoplasmoses present in Europe, causing significant economic losses in apple production. The causal agent, ‘Ca. P. mali’, was identified in apple and Cacopsylla picta samples using both real-time PCR and nested PCR based on the amplification of 16S rDNA. The objective of this study was to gain deeper insights into the epidemiology of apple proliferation in Croatia. Variability of genetic markers other than 16S rRNA was used for characterization of strains. Four molecular markers differing in level of conservation, aceF, pnp, imp, and secY, were selected in line with previously typed fruit tree phytoplasmas. New genotypes were discerned for each genetic marker, and 20 different sequence types were revealed in the Croatian strains of ‘Ca. P. mali’. On the basis of this comprehensive analysis, the founder sequence type ST1 (A13–P10–S12–I21) can be proposed. This is the first extensive research and multigene typing performed on Croatian ‘Ca. P. mali’ strains. Obtained results reveal considerable genetic diversity of epidemiological relevance limited to only two locations in north-western Croatia. Additionally, novel primers were constructed to amplify fragments larger than the entire coding region for all four genes in order to further expand the phytoplasma multi-locus sequence typing scheme.

Abstract Autophagy, a cellular process involved in the degradation and recycling of cellular components, has emerged as a pivotal mechanism for maintaining cellular homeostasis and combating pathogen invasion. Here, we provide evidence that the overexpression of CsATG8c inhibits CLas proliferation in citrus. CsATG8c directly interacts with the CLas effector protein SDE4040, leading to its degradation via the autophagic pathway. The SDE4040 protein acts as a virulence effector, and transgenic citrus plants expressing SDE4040 promote CLas proliferation by suppressing the hypersensitive response (HR) of the host and reducing the levels of jasmonic acid (JA). Collectively, these results demonstrate that ATG8-mediated selective autophagy limits CLas infection by degrading a virulence effector protein, which provides the first evidence for the role of autophagy in combating CLas infection.

Abstract Bactericera maculipennis (Crawford) and Bactericera cockerelli (Šulc) (Hemiptera: Triozidae) share hosts within the Solanaceae and Convolvulaceae (Solanales), and both are associated with “Candidatus Liberibacter solanacearum” (Lso). Lso, transmitted by B. cockerelli, causes diseases in solanaceous crops including zebra chip disease of potato. Up to 50% of B. maculipennis adults also harbor Lso, but transmission of Lso to plants by this psyllid has not been confirmed yet. The only documented field host of B. maculipennis in the Pacific Northwest is Convolvulus arvensis L. (Convolvulaceae) but diagnostic methods fail to detect Lso in leaves of this plant. It is therefore unclear how Lso persists within B. maculipennis populations. We surveyed species of Convolvulaceae and Solanaceae for B. maculipennis and report a widespread association between B. maculipennis and Lso throughout the western United States. Diagnostic polymerase chain reaction failed to detect Lso from leaves of C. arvensis yet readily detected Lso from stems where B. maculipennis nymphs tend to feed. Bactericera maculipennis transmitted Lso to species of Convolvulaceae in greenhouse experiments, confirming vector competency. We report high rates of Lso infection in populations of both B. maculipennis and B. cockerelli occurring on C. arvensis, but occurrence of B. cockerelli on C. arvensis was limited to autumn months only and with very low populations. Results suggest C. arvensis is a non-crop reservoir of Lso but do not suggest that B. maculipennis is a direct threat to solanaceous crops or that C. arvensis is a major source of Lso-infected B. cockerelli colonizing potato fields.

Abstract Citrus greening disease, also known as huanglongbing (HLB), is caused by the gram-negative α-proteobacteria Candidatus Liberibacter species. This disease poses a significant threat to citrus production worldwide, including in Nepal. This study aimed to conduct the diagnosis and phylogenetic analysis of the citrus greening pathogen in Nepal using both conventional PCR and computational methods. A total of 1,026 samples were collected from thirteen districts across six provinces in the country. PCR-based diagnosis was performed using the primer set Las606/LSS, which targets the 16S rRNA gene of Candidatus Liberibacter asiaticus. Additionally, 16S rRNA gene sequencing was performed using sanger sequencing for five samples collected from different geographical regions. The obtained sequences were deposited in GenBank, and a phylogenetic tree was constructed based on these sequences. Among the 1,026 samples tested, 255 were positive, indicating the widespread distribution of HLB across Nepal. All consensus sequences from Nepal showed strong evolutionary relatedness within the C. L. asiaticus cluster, displayed over 99% genetic similarity with reference sequences from various parts of the world. Phylogenetic analysis revealed that the Nepalese sequences were closely related to C. L. asiaticus sequences from India, such as OM522080.1 (Punjab) and MH473394.1 (Meerut). Additionally, sequences obtained from different regions of Nepal clustered closely together. The findings of this research provide valuable insights into the genetic diversity and prevalence of citrus greening disease, which will aid the development of better management strategies to combat this devastating disease. Furthermore, the sequence data deposited in GenBank will serve as a key reference for future molecular studies on citrus greening disease.

In the Campania region of southern Italy, a formerly undescribed witches’-broom disease of cultivated strawberry characterized by symptoms similar to those of strawberry witches’-broom and multiplier diseases occurring in North America, has been observed. Strawberry witches’-broom and multiplier diseases are not known to occur in Europe. To elucidate the etiology of the new strawberry disease occurring in southern Italy and to determine the taxonomic position of the presumable causal agent, field observations and PCR assays using universal and group-specific phytoplasma primers followed by multigene sequence analysis were carried out. All of the symptomatic strawberry plants examined tested phytoplasma positive with universal primers and primers specific to the elm yellows (EY) phytoplasma group or 16SrV group. The percentage of diseased plants in the fields was about 30%. Data obtained from sequence and phylogenetic and virtual RFLP analyses of PCR-amplified rDNA (16S rDNA and 16S/23S rDNA spacer region), rpsV (rpl22) and rpsC (rps3), map, imp and groEL gene sequences, showed that the diseased strawberry plants harbored phytoplasma strains which were identical or nearly identical to each other and to strains of the rubus stunt (RuS) agent ‘Ca. Phytoplasma rubi’, a member of the 16SrV group, subgroup 16SrV-E. The 16S rDNA sequence similarity among the strawberry-infecting phytoplasma strains ranged from 99.1 to 99.9%. These strains shared the same range of 16S rDNA sequence similarity with RuS phytoplasma strains including the reference strain RUS of ‘Ca. Phytoplasma rubi’. This is the first report on the occurrence of RuS phytoplasma in naturally affected strawberry plants.

The X-disease phytoplasma (‘Candidatus Phytoplasma pruni’) is an obligate pathogen that is capable of infection, persistence, and pathogenicity in both its major plant host (Prunus spp.) and leafhopper vector (Colladonus spp.) species. How the ‘Ca. P. pruni’ interacts with its plant and insect hosts, and how it alters its gene expression to do so is unknown, therefore in this study we conducted comparative RNAseq and differential gene expression analysis on ‘Ca. P. pruni’ infected P. avium and C. reductus samples. We found that the phytoplasma altered expression of approximately 32% of its annotated protein coding and pseudogenes, including intercellular transporters, proteolytic activity, its membrane structure, as well as upregulating genes associated with potential mobile units when in insect tissues vs. in plant tissues. Most notably, differential expression was observed in genes that were identified by in silico analysis as being putative secreted effectors that may play a role in allowing phytoplasma infection and survival in these two very different host systems, as well as inducing X-disease in Prunus spp., and offers targets for control by of this damaging pathogen by disrupting phytoplasma-host interactions.

Okra (Abelmoschus esculentus) was cultivated on 1,342 hectares in the United States in 2023, producing 10,540 tonnes (FAOSTAT). During a field survey conducted in 2023, a single okra plant in a plot (roughly 0.1 acre) cultivated in Tulsa County, Oklahoma, displayed symptoms of virescence, phyllody, and witches’-broom. Leaf tissues were collected from one symptomatic (sample K7) and three asymptomatic plants. Total RNA and genomic DNA were extracted using the Plant RNA Isolation Kit (Norgen Biotek Corp, Ontario, Canada) and Plant DNA Kit (Omega BIO-TEK). RNA from the samples was subjected to high-throughput sequencing (HTS) on the NovaSeq X Plus at the Oklahoma Medical Research Foundation. After trimming, 16,454,026 reads (average length = 151 bp) were de novo assembled using CLC Genomics Workbench v22.0.1 (QIAGEN) and analysed via BLASTn and BLASTx analyses against the NCBI GenBank (nr) database. Thirty-six contigs (205-664 bp) showed similarity to the ‘Candidatus Phytoplasma 16SrI group with an average coverage ranging from 1.6 to 118.1X. Later in the season, disease progression was observed on the same plant (K7), and additional symptomatic leaf tissues were collected and processed as described above. The second HTS run yielded 53,701,463 reads (average length = 130 bp). De novo assembly produced 617 contigs (190-15,179 bp), matching ‘Candidatus Phytoplasma asteris’ (rapeseed phyllody phytoplasma, CP055264) with coverage ranging from 2.04 to 23,516.25X. Raw sequencing reads were deposited in the NCBI database under the Sequence Read Archive (SRA) SRR32988524. To confirm the HTS results, PCR was performed using DNA from the K7 sample and healthy okra plants, with two primer sets designed from HTS-derived contigs (1F CTCATCCTGTAAGCGTTGCC, 1R AGCGGCTTTGATGTTGGATC (446 bp), and 2F CCAAACCGCAGTGCTAACAT, 2R GTTTTGACCCCACGAGCTTT (product size 524-bp). Both expected amplicons (446 and 524 bp, respectively) were detected in the symptomatic sample (K7) but none in the asymptomatic sample. Sanger sequencing and BLASTn of the PCR products confirmed 99.03% and 99.8% nucleotide identity to the rapeseed phyllody phytoplasma isolate RP166 (GenBank accession CP055264). Additionally, the full-length 16S rRNA gene (1,521 bp) retrieved from HTS data revealed 99.8% identity with the same isolate. Based on the iPhyClassifier analysis (Wei et al. 2007; Zhao et al. 2009), the phytoplasma strain was classified as ‘Candidatus Phytoplasma asteris’ subgroup 16Srl-B. ‘Candidatus Phytoplasma asteris’ has been previously associated with phyllody in oilseed rape in Poland (Zwolińska et al. 2011), rapeseed phyllody disease (Cho et al. 2020), little leaf disease of cotton and luffa in India (Kumar et al. 2010), tomato stunt in Cuba (Zamora et al. 2014) and other crop diseases. This study presents the first confirmed report of rapeseed phyllody phytoplasma infecting okra in Oklahoma, and United States. Okra is a significant cash crop for both small and large-scale farmers and widely cultivated vegetable in Oklahoma and various other states across the United States. It has numerous nutritional benefits (vitamins, minerals, dietary fibre and antioxidants) in the human diet and traditional medicine. Okra is susceptible to various diseases. Therefore, conducting a comprehensive survey of okra fields is crucial to identify potential disease threats and to implement effective measures for the protection and sustainability of this important crop.

‘Candidatus Phytoplasma solani’ is the causal agent of the Bois noir (BN), affecting grapevine worldwide. The complex epidemiology of BN, which involves multiple ‘Ca. P. solani’ host plants and insect vectors, as well as the occurrence of recovery (loss of symptoms on grapevine canopy), makes disease investigations and containment in vineyards difficult. To achieve early detection of ‘Ca. P. solani’, a droplet digital PCR (ddPCR)-based approach and quantitative (q)PCR assay were compared, testing specific primers based on the elongation factor Tu (tuf) gene using SYBR Green chemistry. The regression curve analysis of the ddPCR assay showed good linearity. Compared with the qPCR method, the sensitivity of ddPCR improved about 10-fold. The analysis of grapevine roots spiked with serial dilutions of ‘Ca P. solani’. PCR tuf fragments showed that qPCR was inhibited, while ddPCR was not affected. Testing 66 grapevine samples from 50 grapevine plants, the ddPCR provided superior diagnostic performance compared to qPCR in roots of symptomatic plants (75% detected by ddPCR, 41.6% by qPCR), roots of recovered plants (58.8% detected by ddPCR, 25% by qPCR), and asymptomatic leaf tissues from recovered plants (75% detected by ddPCR, 25% by qPCR). The ddPCR analysis allowed us to detect ‘Ca. P. solani’ on 40% of leaf samples from recovered plants and 20% of roots from asymptomatic plants. No differences among ddPCR and qPCR were found in detecting phytoplasma on symptomatic leaf samples. The ddPCR assay allowed the absolute quantification of ‘Ca. P. solani’ in complex matrices, such as roots, and when low titer of phytoplasma is present.