Plant Science

Huanglongbing (HLB) (ex-greening) is one of the most serious diseases of citrus. The causal agent is a noncultured, sieve tube-restricted α-proteobacterium, “Candidatus Liberibacter africanus” in Africa and “Candidatus Liberibacter asiaticus” in Asia (2). The disease has never been reported from the American continent. However, Diaphorina citri, the Asian psyllid vector of HLB, is found in South, Central, and North America (Florida and Texas). Early in 2004, leaf and fruit symptoms resembling those of HLB were observed in several sweet orange orchards near the city of Araraquara, Sao Paulo State. Leaf mottling on small and large leaves was the major symptom. Shoots with affected leaves were yellowish. Fruits were small and lopsided, contained many aborted seeds, and appeared more severely affected than were plants infected with classic HLB. Forty-three symptomatic samples and twenty-five samples of symptomless sweet orange leaves from five farms were analyzed for the presence of the HLB-liberibacters using polymerase chain reaction (PCR) with two sets of HLB-specific primers for amplification of 16S rDNA (2,3) and ribosomal protein genes (1). None of the 43 symptomatic leaf samples gave a positive PCR amplification, while HLB-affected leaves from the Bordeaux HLB collection produced the characteristic amplicons with both sets of primers. The 43 symptomatic and the 25 symptomless leaf samples were then analyzed using PCR with universal primers for amplification of bacterial 16S rDNA (4). All symptomatic leaf samples, but none of the symptomless leaf samples, yielded the same 16S rDNA amplification product, indicating the presence of a bacterium in the symptomatic leaves. This was confirmed using the observation of a sieve tube restricted bacterium by electron microscopy. The 16S rDNA product was cloned, sequenced, and compared with those of “Ca. L. africanus” and “Ca. L. asiaticus”. While the 16S rDNAs of these two liberibacter species have 97.5% sequence identity, the 16S rDNA sequence of the new bacterium shared only 93.7% identity with that of “Ca. L. asiaticus” and 93.9% with that of “Ca. L. africanus”. The 16S rDNA sequence of the new bacterium had a secondary loop structure characteristic of the α subdivision of the proteobacteria and possessed all the oligonucleotide signatures characteristic of the liberibacters. For these reasons, the new bacterium is a liberibacter and is sufficiently different phylogenetically from known liberibacters to warrant a new species, “Candidatus Liberibacter americanus”. Specific PCR primers for amplification of the 16S rDNA of the new species have been developed. They were able to detect “Ca. L. americanus” in 214 symptomatic leaf samples from 47 citrus farms in 35 municipalities, while the “old” species, “Ca. L. asiaticus”, has been found only four times within the 47 farms. References: (1) A. Hocquellet et al. Mol. Cell. Probes, 13:373, 1999. (2) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Huanglongbing (ex-greening) disease is one of the most serious diseases of citrus. It is caused by the phloem-limited, gram-negative bacterium “Candidatus Liberibacter spp.”. This bacterium is not well characterized mainly because it is still uncultured. There are two known strains, Asian (“Candidatus Liberibacter asiaticus”) and African (“Candidatus Liberibacter africanus”) that cause severe damage to citrus plants including twig dieback, decline, and death. Symptoms first appear as leaf mottling and chlorosis occurring in one shoot or sector of trees. Later, leaf symptoms resemble nutritional deficiencies (Zn, Ca, and N) that vary depending on the strains, with more severe symptoms caused by “Ca. L. asiaticus”. The Asian strains are transmitted by the Asian citrus psyllid (AsCP), Diaphorina citri, which is present in Brazil. The bacterium has been detected in citrus plants in many geographic locations including China, Japan, Thailand, India, the Philippines, the Arabian Peninsula, and Africa. In 2004, plants showing Huanglongbing symptoms were observed in the Araraquara County, a central region of the State of Sao Paulo, the largest citrus-producing area in Brazil. To verify the presence of “Ca. L. spp.” in these plants, leaf samples of sweet orange cvs. Hamlin and Valencia were used for DNA extraction and polymerase chain reaction amplification using the specific OI1 and Oi2c primers (1). Amplification of the 16S rDNA was positive for 2 (cvs. Hamlin and Valencia) of 10 analyzed plants. The amplified fragments were cloned and sequenced. The amplicons obtained from both plants showed the same sequence, which differed from “Ca. L. africanus”, utilized as the positive control in the amplification experiment (27 divergent bases in 1,160). The sequences were used for BLAST searches, and the results showed identities ranging from 94.71 to 100% with “Ca. L. spp.” sequences available at the National Center for Biotechnology Information database (on-line publication). The highest scores were obtained with “Ca. L. asiaticus sequences. These analyses confirmed the presence of such agent in the State of Sao Paulo. To our knowledge, this is the first report of “Ca. L. asiaticus” in Brazil as well as elsewhere in the Americas. The significance of this report relates to the potential damage that this pathogen could cause to the citrus industry in the largest citrus-producing country in the world. It remains unclear how and when the pathogen entered Brazil. Reference: (1) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996.

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.